Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-888-3p URS0000759E8F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-888: Hsa-mir-888 is a microRNA that has been studied in various contexts [PMC9829716]. In a study analyzing the enrichment of different miRNAs, hsa-mir-888 was found to not be enriched by the circPOFUT1 probe [PMC9829716]. Another study found that hsa-mir-888 was expressed in HEK 293 cells overexpressing exogenous hsa-mir-888 [PMC6019656]. In follicular fluid, hsa-mir-888 was found to have high expression levels in oocytes that became low-grade embryos [PMC9425991]. Additionally, hsa-mir-888 was identified as one of the miRNAs associated with poor prognosis in osteosarcoma patients [PMC9553349]. The number of target genes regulated by hsa-mir-888 was found to be 2 [PMC9059551]. In the context of embryo quality, hsa-mir-888 was differentially expressed in follicular fluid from oocytes that developed into top quality embryos compared to non-top quality embryos [PMC6242846]. Hsa-mir-888 was also associated with impaired embryo quality when overexpressed [PMC6242846]. Furthermore, somatic mutations were identified in the hsa-mir-888 gene among others in lymphocyte DNA [PMC3334977].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GACUGACACCUCUUUGGGUGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications