Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-721 URS0000759E79_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-721: The mouse miRNA mmu-mir-721 is a microRNA that is produced by Th17 cells [PMC9340754]. It has been found to be highly expressed in mouse models of experimental autoimmune myocarditis and coxsackievirus-induced myocarditis, but not in mice with myocardial infarction [PMC9340754]. Mmu-mir-721 has been shown to target the mitogen-activated protein kinase 1 (Mapk1), a kinase involved in various signaling pathways [PMC4531287]. It has also been found to be upregulated in Th17 cells and has diagnostic significance for acute myocardial infarction (AMI) [PMC9846646]. Mmu-mir-721, along with mmu-miR-221-3p, mmu-miR-222-3p, mmu-miR-130b-3p, and mmu-miR-27a/b-3p, can regulate the expression of FOS and PPARG [PMC6526899]. Mmu-mir-721 is present in the plasma of mice with autoimmune or viral myocarditis but not in those with AMI [PMC9995594]. It belongs to the same miRNA family as mmu-miR130b-3p and is predicted to share target mRNAs with it [PMC5595893]. Mmu-mir 721 is also upregulated during pneumonia and expressed at moderate to high levels in lung neutrophils [PMC5595893]. The human homolog of mmu-mir 721, hsa-Chr8:96, has been identified as a potential biomarker for acute myocarditis in patients [PMC9865796]. In a murine model, Th17 cells have been shown to upregulate mmu-mir 721 among other dysregulated miRNAs [PMC9082251].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGUGCAAUUAAAAGGGGGAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications