Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-135b precursor URS0000759E75_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR135B: MIR135B is a downregulated miRNA in PWS INS-1 lines, along with Mir3065 and Mir212, although their predicted targets were not differentially expressed genes (DEGs) by RNA-seq [PMC10138222]. Experimental evidence has shown that in an in vitro miRNA system, both miR135a and MIR135B interact with the 3’UTR transcript of the APC gene, affecting mRNA levels and regulating APC expression [PMC3843547]. This regulation of APC expression by MIR135B and miR135a has implications for the Wnt proliferation control pathway [PMC3843547].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CACUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUCCCAAACUCAUGUAGGGCUAAAAGCCAUGGGCUACAGUGAGGGGCGAGCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 11 other species

Publications