Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-6775-5p URS0000759DC2_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-6775: Hsa-mir-6775 is a microRNA that is reported to silence the transcription of the alpha 7-cholinergic nicotinic receptor gene (CHRNA7) expressed on lymphocyte surface and associated with lymphocyte anergy, T regulatory cell differentiation, and immunologic tolerance, which may predispose to cancer development [PMC8288189]. In a study on papillary thyroid microcarcinoma (PTMC), the expression of hsa-mir-6775 was found to be decreased in PTMC with lymph node metastasis [PMC9281586]. The study also found that hsa_circRNA_000121 may increase the expression level of MMP-14 by downregulating the expression of hsa-mir-6775, which may play a role in PTMC invasion [PMC9281586]. However, binary logistic regression analysis showed that the expressions of hsa-mir-6775 in PTMC tissues were not significantly related to lymph node metastasis [PMC9281586]. The study also suggested that hsa_circRNA_000121 may regulate PTMC invasiveness by inhibiting the effects of hsa-miR-4763 and hsa-mir-6775 [PMC9281586]. Furthermore, it was proposed that hsa_circRNA_000121 may upregulate the expression of MMP-14 by binding to hsa-mir-6775, enhancing the aggressiveness of PTMC and leading to cervical lymph node metastasis in patients [PMC9281586].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCGGGGCAUGGGGGAGGGAGGCUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications