Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-3685 URS0000759D24_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-3685: Hsa-mir-3685 is a microRNA that has been found to regulate RPLP0 and PLCG1 [PMC7901211] [PMC9967176]. It is also associated with the risk of cardiovascular diseases [PMC9967176]. In addition, hsa-mir-3685 has been identified as a potential biomarker for polycystic ovary syndrome (PCOS) [PMC7901211]. Furthermore, hsa-mir-3685 has been implicated in the development of pancreatic cancer, as it is one of the miRNAs found in pancreatic cancer tissue samples [PMC7962059]. It is worth noting that hsa-mir-3685 is one of several miRNAs that have been identified as potential biomarkers for various diseases, including colorectal cancer and cardiovascular diseases [PMC9967176] [PMC7962059]. In a study on colorectal cancer, hsa-mir-3685 was found to be one of the miRNAs associated with this disease [PMC7962059]. Furthermore, in another study on pancreatic cancer, hsa-mir-3685 was also identified as one of the miRNAs associated with this type of cancer [PMC7962059]. Overall, hsa-mir-3685 appears to play a role in various diseases and may have potential diagnostic or therapeutic applications.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUUCCUACCCUACCUGAAGACU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications