Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) mmu-miR-1907 URS0000759D1F_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-1907: Mmu-mir-1907, a miRNA, was quantified using a Taqman assay [PMC7603330]. It was predicted to be a downstream target of circ_0000811 [PMC9068921]. In an OIR group, mmu-mir-1907 showed the highest fold-change compared to the control group [PMC5355681]. Real-time PCR was performed to investigate the expression of mmu-mir-1907 in brain tissue [PMC5544724]. It was also predicted to be involved in the circRNA-miRNA-mRNA network, potentially affecting the expression of target mRNAs by sponging mmu-miR-326-5p, mmu-miR-761, or mmu-miR-3473 [PMC8447959].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGCAGCAGAGGAUCUGGAGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications