Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-8063 URS0000759D19_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-8063: Hsa-mir-8063 is a microRNA that has been identified as a novel biomarker for the progression of gestational diabetes mellitus (GDM) [PMC8145272]. It has also been found to be differentially expressed in the blood of colorectal cancer patients who developed venous thromboembolism (VTE) [PMC9361765]. In addition, hsa-mir-8063 has been implicated in promoting colorectal cancer (CRC) through its binding potential with the long non-coding RNA CCAT1 [PMC8739552]. It is also predicted to interact with hsa_circRNA_000102, along with several other miRNAs and mRNAs [PMC7388456]. Furthermore, hsa-mir-8063 has been shown to inhibit pancreatic cancer progression by targeting ZFP91 [PMC9455708]. Overall, hsa-mir-8063 is a microRNA that has been implicated in various diseases and biological processes. Its differential expression in GDM and its potential as a biomarker for disease progression highlight its importance in understanding and managing this condition. Its involvement in CRC and pancreatic cancer suggests its potential as a therapeutic target for these malignancies. Further research is needed to fully elucidate the mechanisms by which hsa-mir-8063 functions and its potential clinical applications. References: [PMC8145272] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8145272/ [PMC9361765] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9361765/ [PMC8739552] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC8739552/ [PMC7388456] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7388456/ [PMC9455708] - https://www.ncbi.nlm.nih.gov/pmc/articles/PMC9455708/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCAAAAUCAGGAGUCGGGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications