v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) family with sequence similarity 224 member A (FAM224A) URS0000759CFB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FAM224A: FAM224A is a gene that has been implicated in tumor suppression. In a study, the tumor-suppressive effects of FAM224A knockdown were investigated [PMC6558706]. The study divided cells into five groups to evaluate the role of miR-590-3p in mediating these effects [PMC6558706]. The groups included a control group, as well as groups with FAM224A knockdown and different combinations of miR-590-3p and anti-miR-590-3p [PMC6558706]. The expression levels of FAM224A were examined using qRT-PCR, and it was found that FAM224A was significantly upregulated in glioma tissues and cell lines compared to normal brain tissues and normal human astrocytes (NHA) [PMC6558706]. This suggests that FAM224A may play a role in glioma development or progression [PMC6558706]. Further research is needed to fully understand the mechanisms by which FAM224A functions in tumor suppression and its potential as a therapeutic target for glioma.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGAGUGGGGAACUGCGGGCAGGUCGGCGGAGUUAGAUGGCAGCAAAGGUGGGCCGGCUUGGUGUGAUAAAGUUCCAACUGGGUCCUUCCGCGAGCCCUGGGUCCAUAAGAUGUCAUCGGCGAGCGCUGGACUUGACCGUCAACUUGGGAUUGUUAAGGUAAAUGGUGUCUCCUUCUGUCGCCAAGGCGGUGGCAUGGUCUCGGCUGGCUGCAAUCUCCACCUCCUUGCUUCCAGCGAUUCUCCUGCCUCAGCCCCCCGAGUAGCAGAAAUUACAGGAGUUUCAUGGCAGGGCGCUUGGCUGGCUUGUUUAAAUUCAUUCUGAAUAAGAACUGAGGAUGUCAGCUUCUGGCCUCAUGGACUCUGGACUGAAGAGUCCCCUUGUCUAUCUAUCAUGAGACUGUACACGUAAGAAGCAAAAAACUAGUAACAUUUAAAAUAAAUAAUUUUGUUGUACAGAAAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications