Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-539 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-539 precursor URS0000759CA5_9606

  • 78 nucleotides
  • 8 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq)
  • Found in 15 species

Automated summary: This pre miRNA sequence is 78 nucleotides long and is found in Homo sapiens. Annotated by 8 databases (Ensembl/GENCODE, RefSeq, Ensembl, MalaCards, ENA, GeneCards, HGNC, miRBase). Described in 36 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-154, RF00641). Homo sapiens (human) microRNA hsa-mir-539 precursor sequence is a product of mir-539 precurso, mir-539, mir-539 precursor, hsa-mir-539 precursor, MIR539 genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AUACUUGAGGAGAAAUUAUCCUUGGUGUGUUCGCUUUAUUUAUGAUGAAUCAUACAAGGACAAUUUCUUUUUGAGUAU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Cercocebus atys (Sooty mangabey) miRNA
    2. Colobus angolensis palliatus microRNA 539
    3. Dasypus novemcinctus (nine-banded armadillo) microRNA 539
    4. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 539
    5. Macaca fascicularis miRNA
    6. Macaca mulatta microRNA mml-mir-539 precursor
    7. Macaca nemestrina miRNA
    8. Mandrillus leucophaeus (Drill) miRNA
    9. Pan troglodytes (chimpanzee) ptr-mir-539
    10. Papio anubis (Olive baboon) miRNA
    11. Piliocolobus tephrosceles (Ugandan red Colobus) miRNA
    12. Pongo abelii microRNA 539
    13. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-539 precursor
    14. Rhinopithecus bieti miRNA
    15. Rhinopithecus roxellana miRNA
    2D structure New