Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bos taurus (cattle) microRNA bta-mir-2484 precursor URS0000759C56_9913

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

bta-mir-2484: Bta-mir-2484 is a microRNA that has been found to exhibit increased expression in the peripheral blood mononuclear cells (PBMCs) of buffaloes infected with Mycobacterium paratuberculosis [PMC7242893]. It is one of the top three up-regulated miRNAs in these infected buffaloes, along with bta-miR-592 and bta-miR-1247-5p [PMC5766512]. Interestingly, bta-mir-2484 has also been detected in mammary glands infected with Staphylococcus aureus, suggesting a potential association between these two infections [PMC6600136]. It is worth noting that bta-mir-2484 appears to be nearly species-specific and does not have homologs in humans or mice [PMC6600136]. In a study validating the results obtained from RNA sequencing, bta-mir-2484 was one of the six miRNAs selected for examination using RT-qPCR [PMC6600136]. Additionally, it has been found to regulate CYP7A1 along with two other miRNAs (bta-miR-27a-3p and bta-miR-194) and one long non-coding RNA in a grass-fed group [PMC7969984].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UUAUCUGAAAAUGUAUGCAGGGUUAUUAUAAUUAAAAAGGUGAGCUAUGAUGACUUUGAUUGCAUUGAUCACAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications