Automated summary: This pre miRNA sequence is 76 nucleotides long and is found in Bos taurus. Annotated by 4 databases (ENA, RefSeq, miRBase, Ensembl). Bos taurus (cattle) microRNA bta-mir-2484 precursor sequence is a product of mir-2484 precursor, 2484, ENSBTAG00000050756.1, bta-mir-2484 precursor, mir-2484 precurso, MIR2484, ENSBTAG00000049141.1, mir-2484 genes. Found in the Bos taurus reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
UUAUCUGAAAAUGUAUGCAGGGUUAUUAUAAUUAAAAAGGUGAGCUAUGAUGACUUUGAUUGCAUUGAUCACAUGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.