Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-892a precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-892a precursor URS0000759C52_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-892a: Hsa-mir-892a is a microRNA that has been studied in various contexts [PMC8833493]. It has been found to be a standalone marker for differentiating A from BC, with an area under the curve of 0.894, specificity of 0.846, and sensitivity of 0.875 [PMC8833493]. Hsa-mir-892a has also been identified as a putative target for hsa_circ_0044235 in the context of systemic lupus erythematosus (SLE) [PMC6713423]. The level of hsa-mir-892a was significantly increased in patients with SLE compared to healthy controls [PMC6713423]. The functions of hsa-mir-892a have not been described previously [PMC6713423]. Hsa-mir-892a has also been identified as one of the putative microRNAs that target the 3'UTR region of hCYP1A1 [PMC5220472]. It is one of the nine overlap miRNAs between two types of miRNAs and could be considered as a final target miRNA [PMC8612294]. Hsa-mir-892a was not profiled in plasma samples from colorectal cancer patients, but other miRNAs were identified as part of a signature for early-stage and advanced colorectal cancer [PMC5981448]. Hsa-mir-892a has also been found to interact with differentially expressed circRNAs in atrial fibrillation and other contexts [PMC7390851].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCAGUGCCUUACUCAGAAAGGUGCCAGUCACUUACACUACAUGUCACUGUGUCCUUUCUGCGUAGAGUAAGGCUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications