Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-344g precursor URS0000759C1A_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-344g: Rno-mir-344g is a miRNA that is involved in the regulation of hub mRNA functions in a network of lncRNAs and miRNAs [PMC7503504]. This network suggests that several lncRNAs, including NONRATT002662, NONRATT005090, NONRATT005619, NONRATT019513, NONRATT027738, NONRATT027888, and NONRATT030038, competitively bind to miRNAs such as rno-mir-344g [PMC7503504]. These interactions can affect the expression and function of hub mRNAs such as Pomc, Htr2a, and Agtr1a [PMC7503504]. Rno-mir-344g is one of the miRNAs that can interact with both Htr2a and Agtr1a [PMC7503504]. In a study comparing liver tissues in a model group to a control group, rno-mir-344g was found to be markedly underexpressed in the liver tissues of the model group compared to the control group [PMC6102666]. Microarray analysis also revealed that rno-mir-344g was significantly downregulated in the model group compared to the control group [PMC6102666]. The differentially expressed miRNAs identified in this study had numerous target genes, indicating their wide role in regulatory activities in vivo [PMC6102666].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAUUUCUGUCAGUCAGGCUCCUGGCAGGAGUCCAGCUCUCAGCUGGUUCCAGGCUCUAGCCAGGGGCUUGACUGCAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications