Rhinopithecus bieti (Black snub-nosed monkey) microRNA 1260b (ENSRBIG00000012436.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rhinopithecus bieti (Black snub-nosed monkey) microRNA 1260b (ENSRBIG00000012436.1) URS0000759BF7_61621

89 nucleotides
1 database (Ensembl)
Found in 9 other species
19 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UCUCCGUUUAUCCCACCACUGCCACCAUUAUUGCUACUGUUCAGCAGGUGCUGCUGGUGGUGAUGGUGAUAGUCUGGUGGGGGCGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Cercocebus atys microRNA 1260b (ENSCATG00000043312.1)
Colobus angolensis palliatus miRNA (ENSCANG00000015837.1)
Gorilla gorilla gorilla microRNA 1260b (ENSGGOG00000041254.1)
Homo sapiens microRNA hsa-mir-1260b precursor
Mandrillus leucophaeus (Drill) microRNA 1260b (ENSMLEG00000017913.1)
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 1260b (ENSNLEG00000024506.2)
Pan paniscus (bonobo) microRNA 1260b (ENSPPAG00000015151.1)
Pan troglodytes microRNA mir-1260b (ENSPTRG00000040955.2)
Rhinopithecus roxellana microRNA 1260b (ENSRROG00000006847.1)

2D structure

Publications