Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-1260b precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-1260b precursor URS0000759BF7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1260B: MIR1260B is a microRNA molecule that has been found to have a close association with the Serin/Treonin-protein kinase family member of CHEK2 protein and cycline dependent kinase family members of CDK4 protein [PMC8504092]. It has been suggested that the expression of MIR1260B in peripheral blood lymphocytes may have prognostic significance and could be used as a bioindicator [PMC8504092]. The gene targets of MIR1260B, as detected from miRTarBase and TargetScan, have been found to interact at the protein level according to analysis performed using the String database [PMC8504092]. The significant expression of MIR1260B in peripheral blood lymphocytes has been demonstrated in ovarian cancer patients compared to healthy controls, suggesting its potential diagnostic significance in ovarian cancer [PMC8504092]. In a study using qPCR, TaqMan primers were used to analyze the expression of MIR1260B [PMC6144919]. It has also been shown that MIR1260B is involved in regulating SFRP1 expression in prostate cancer [PMC8869457]. Genistein treatment has been found to modulate the levels of various miRNAs, including MIR1260B, and affect cancer cell proliferation in prostate cancer [PMC7072821]. Furthermore, HNRNPK interacts with several genes including MIR1260B at the protein level [PMC9730017]. The abundance of MIR1260B in A-exosomes suggests its potential role in targeting specific mRNA and genes with functional consequences [PMC8176431]. In addition, miR1260a and MIR1260B were downregulated on day 7 compared to baseline samples on day 1 [PMC7169272]. Other miRNA genes located on 11q include MIR3166, miR3167, and MIR1260B, but their functions are unknown [PMC5492892]. Genistein treatment has been found to down-regulate MIR1260B expression in prostate cancer cells [PMC5068501].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCCGUUUAUCCCACCACUGCCACCAUUAUUGCUACUGUUCAGCAGGUGCUGCUGGUGGUGAUGGUGAUAGUCUGGUGGGGGCGGUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications