v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1194 (LINC01194) URS0000759BD5_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01194: In the present work, miR-641 was identified as the downstream target of LINC01194, suggesting that LINC01194 acts as a sponge for miR-641 [1]. The specific steps for this discovery can be found in the work by Barnes and Kanhere [2].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCCACACCGCCUUGCAAGCUGAGGGAGCCGGCUCCGGCCUCUGCCAGCCCAGGAAGGGGCUCCCACAGUGCAGCGGCGGGCUGAAGGACUCCUCAAGUGCCACCAAAGUGGGAGCCCAGGCAGAGGAGGCGCCGAGAGCGAGCGAGGGCUGCCUGCCAGCACGCUGUCACGUCUCAGCAAUAGACUGCUCUUGAGGCUGGAGUGCAAUGUUGUUAUCAUAGCUCACUGCAACCUGGAACCCCUAGUCUCAAGAGAUCCUCCAGCCUCAGCCUCCCUGUUCCAGGAUACAUGUGCAGGAUGUGCAAGUUUGCUACAUGGGUAAAUAUGUGCCAUGGCAGUUUGCUGCAUCUAUUAACCCAUUACCUAGGUAUUAAGCCCGAUCCCAGAAAACCUGCAGAGAGAAGCAGCAGCUGGACCUCGGGAUGACUAUGGCUGGACGUCAGGAGAGAAGCAGUUUGACUUCAGAGGGACAGCUUGAUGGUGUAACUUCAGAGAAGAAUCUGGUUAGAGAUGGCUAGACUCCAGGAAAAGAUUACCUACCCUUCCCCUACCCUUUUCUCAGCUCCCCUUCCCACUGAGAGCCACUUUCACCGCAAUAAAAUCCCCCACAUGCACUAUCCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications