Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4433b precursor URS0000759BCF_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4433b: Hsa-mir-4433b is a miRNA precursor that gives rise to the miRNAs hsa-mir-4433b-3p and hsa-mir-4433b-5p [PMC4486185]. In a study, several critical miRNAs, including hsa-mir-4433b, were identified through screening [PMC7505395]. The test value of hsa-mir-4433b with more 0 value may lead to a high P value [PMC7505395]. The expression patterns of eight specific miRNAs, including hsa-mir-4433b, were verified in test data from PC samples and control samples [PMC7505395]. Hsa-mir-99b, hsa-mir-4433b, and hsa-mir28 were among the 10 most highly expressed miRNAs in PC storage on the 2nd day but were replaced by other miRNAs on the 4th day [PMC4486185]. Hsa-miR221, HSA-MIR22, and HSA-MIR423 were among the most highly expressed miRNAs in PC storage but have not been previously associated with platelet physiology [PMC4486185]. References: [PMC4486185] - Kirschbaum NE et al. (2015) Expression profile of platelet microRNAs associated with the 5-day apheresis process. Transfusion 55(6):1152-1163. [PMC7505395] - Zhang Y et al. (2020) Identification of key genes associated with platelet transfusion refractoriness in patients with acute leukemia. Medicine (Baltimore) 99(28):e21099. [PMC4486185] - Kirschbaum NE et al. (2015) Expression profile of platelet microRNAs associated with the 5-day apheresis process. Transfusion 55(6):1152-1163.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUGUUCCCUAUCCUCCUUAUGUCCCACCCCCACUCCUGUUUGAAUAUUUCACCAGAAACAGGAGUGGGGGGUGGGACGUAAGGAGGAUGGGGGAAAGAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications