Otolemur garnettii (small-eared galago) microRNA 200b (ENSOGAG00000026533.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Otolemur garnettii (small-eared galago) microRNA 200b (ENSOGAG00000026533.1) URS0000759B8C_30611

59 nucleotides
1 database (Ensembl)
Found in 4 other species
224 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCAUCUUACUGGGCAGCAUUGGAUGGUGUCUGGUCUCUAAUACUGCCUGGUAAUGAUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Bos taurus microRNA bta-mir-200b precursor
Erinaceus europaeus (western European hedgehog) microRNA 200b (ENSEEUG00000016151.1)
Ovis aries microRNA oar-mir-200b precursor
Tupaia belangeri miRNA (ENSTBEG00000017931.1)

2D structure

Publications