Automated summary: This pre miRNA sequence is 59 nucleotides long and is found in Bos taurus. Annotated by 3 databases (miRBase, ENA, RefSeq). Described in 6 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-8, RF00241). Bos taurus (cattle) microRNA bta-mir-200b precursor sequence is a product of bta-mir-200b precursor, mir-200b precurso, 200, mir-200b, MIR200B, 200b, mir-200b precursor genes. Found in the cattle reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
CCAUCUUACUGGGCAGCAUUGGAUGGUGUCUGGUCUCUAAUACUGCCUGGUAAUGAUGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.