Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-4505 precursor URS0000759B6A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-4505: Hsa-mir-4505 is a microRNA that has been studied in various contexts, including infectious diseases, cardiovascular events, and cancer. It has been shown to be involved in the regulation of target genes such as C8orf37, EFNA5, HOOK3, MYOZ3, PCP4L1, SLC2A3, SNRPA1, IQCG, PLAG1, and POLI [PMC9738797]. In the context of infectious diseases and HIV infection specifically, hsa-mir-4505 has been found to be downregulated in different comparisons such as VP vs HIV-, EC vs HIV-, and ART vs HIV- [PMC4865051]. In cardiovascular events patients and non-small cell lung cancer (NSCLC), hsa-mir-4505 was found to be downregulated [PMC9827273] [PMC6830863]. However, the role of hsa-mir-4505 in cardiovascular risk or disease is not yet known [PMC9827273]. In NSCLC specifically hsa-mir-4505 was found to be regulated by lncRNA DGCR5 [PMC6830863]. Hsa-mir-4505 has also been shown to target S100A12 and regulate heat shock protein A12B (HSPA12B) in vascular endothelial cell injury induced by lipopolysaccharide (LPS) [PMC9436632]. Furthermore a miRNA-mRNA regulatory network was constructed that included hsa-mir-4505 targeting RBM28 mRNA among others [PMC9532133]. However the expression levels of hsa-mir-4505 were not proven to be significant in some studies [PMC4416288]

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGAGGCUGGGCUGGGACGGACACCCGGCCUCCACUUUCUGUGGCAGGUACCUCCUCCAUGUCGGCCCGCCUUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications