Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 314 (LINC00314) URS0000759B51_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC00314: LINC00314 is a long non-coding RNA (lncRNA) that plays a critical role in the regulation of osteogenic differentiation of adipose-derived stem cells (ADSCs) [PMC7302136]. It is located on chromosome 21 with open reading frame 94 [PMC7302136]. LINC00314 was found to be significantly upregulated during the osteogenic differentiation of ADSCs [PMC7302136]. It acts as a sponge for miR-129-5p, thereby promoting the expression of GRM5, a gene involved in the Wnt/β-catenin signaling pathway [PMC7302136]. Overexpression of LINC00314 was shown to enhance osteogenic differentiation, as indicated by increased expression of osteogenic markers and increased ALP activity and calcified nodule formation [PMC7302136]. On the other hand, silencing LINC00314 suppressed these effects [PMC7302136]. The interaction between LINC00314 and miR-129-5p was predicted using bioinformatics analysis and confirmed by experimental data [PMC7302136]. The binding site between LINC00314 and miR-129-5p was identified using bioinformatics databases [PMC7302136]. The role and mechanism of LINC00314 in ADSC osteogenic differentiation had not been previously explored before this study [PMC7302136]. The study also identified other lncRNAs that may play a role in osteoporosis development or management, including MALAT1, NEAT1, DANCR, SNHG1, MIR22HG, and LINC00314 [PMC10137190]. In conclusion, LINC00314 is an upregulated lncRNA during ADSC osteogenic differentiation that acts as a sponge for miR-129-5p to promote GRM5 expression through the Wnt/β-catenin signaling pathway, thereby enhancing osteogenic differentiation [PMC7302136].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAGACAUGUAUCUCAUUAUCUUCUGCAAAGAUCUAUUUGUUUAGCCAUGUGCAAAUAUUGCCCUAAAAUGUUCACAGGUUCCAGGAUAACCAGAUGACUGAGGAAUGUUGAAGAUUGCAGUGAUGGAAGUGUCUCAGUCAGCCUGGAAGACUGUAUGGAAGGAGGUUGCCUGGCCACACUGUCAUGUCCCCCUCUCCCUAAAAAAGGGACACAUUUGCCUUUGUGCAAGGCAACACAUACAUUUGGUCUGUGUAUAUACUUUGGUCUAUGUAUUCUGUUAUUUAACAUUCUAAUAAUGUUGAUGACCUUAAAAUAUGUUUGACAAUGAUCCUUGUAAAUCAUUAUUAUUCUGCCUUCUGCAAGAUAAGAAUUAUGGGCCAGGUAUGGCACUUAACGCCUAUAAUACAAACAUUUUGGGAGGCCCAGGCAGGAGGAUUGCUUGAGCUCAGGAGUUAGAGACCAGCUUGGGCAACAUAGUGAGACCUCAUCUCUACUAAAAAUAAAACAAAAAAAGUUAUGAUAGUGACACUGCACUCCAGCCUGGGUGACAGAGCAAGAUCCUGUAUCCAAAUAAAUAAAUGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications