Bison bison bison (American bison) microRNA 449a (ENSBBBG00000016167.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Bison bison bison (American bison) microRNA 449a (ENSBBBG00000016167.1) URS0000759A91_43346

88 nucleotides
1 database (Ensembl)
Found in 10 other species
60 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGUGUGAUGGGUUGGCAGUGUAUUGUUAGCUGGUUGAAUAUGUGAGUGCCAUCAGCUAACAUGCAACUGCUAUCUUAUUGCAUGUAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 10 other species

Bos grunniens microRNA 449a (ENSBGRG00000021470.1)
Bos indicus x Bos taurus miRNA (ENSBIXG00000002201.1, ENSBIXG00005011688.1)
Bos mutus (wild yak) microRNA 449a (ENSBMUG00000023189.1)
Bos taurus microRNA bta-mir-449a precursor
Capra hircus microRNA chi-mir-449a precursor
Cervus elaphus hippelaphus ncRNA
Cervus hanglu yarkandensis microRNA 449a (ENSCHYG00000024100.1)
Ovis aries miRNA (ENSOARG00000024705.1, ENSOARG00020012915.2)

2D structure

Publications