Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-517c precursor URS0000759A4A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR517C: MIR517C is a miRNA gene that belongs to the C19MC miRNA gene cluster. It has been studied in various contexts, including liver hepatocellular carcinoma (LIHC) and breast invasive carcinoma, where its expression was analyzed in integrated RNA-seq and miRNA-seq datasets [PMC7378193] [PMC6193703]. In an individual from Tibet, MIR517C was found to be under copy number variations (CNVs) along with its target gene DBN1 [PMC3938728]. MIR517C has been associated with tissue-specific regulation of biological processes, including immune system processes in the tibial artery and thyroid, regulation of neurogenesis and regulated secretory pathway in the brain, synapse-associated processes and extracellular structure organization and biogenesis in skeletal muscle, sperm-associated pathways in testis, and ovulation cycle and ectoderm-associated pathways in the vagina [PMC7750953]. Copy number variations in the chr.19q13.41–42 region have been associated with MIR517C overexpression [PMC8508841]. In acute promyelocytic leukemia, MIR517C expression has been studied along with miRNA-126-5p and miRNA-13 to explore their correlation with clinicopathological features [PMC8993542]. In women with recurrent pregnancy loss (RPL), MIR517C was found to be upregulated in the decidua compared to normal controls [PMC5572592]. Overall, these studies provide insights into the expression patterns and potential roles of MIR517C across different diseases and biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAGAUCUCAGGCAGUGACCCUCUAGAUGGAAGCACUGUCUGUUGUCUAAGAAAAGAUCGUGCAUCCUUUUAGAGUGUUACUGUUUGAGAAAAUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications