Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-606 URS00007599CB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-606: Hsa-mir-606 is a microRNA that has been found to interact with various messenger RNAs (mRNAs) in different biological processes. It has been shown to interfere with the mRNAs of C8orf37, EFNA5, HOOK3, MYOZ3, and PCP4L1, among others [PMC9738797]. Additionally, hsa-mir-606 is one of the miRNAs that target the mRNA of SLC2A3 and SNRPA1 [PMC9738797]. It has also been found to interfere with the transcripts of IQCG, PLAG1, and POLI [PMC9738797]. Hsa-mir-606 is listed as one of the miRNAs that target FN1 in a study on obesity-associated type 2 diabetes mellitus [PMC8074411]. Furthermore, hsa-mir-606 is among the miRNAs with downregulated expression in certain conditions such as glioma and HIV infection [PMC7670263][PMC4175465]. It has also been identified as having a binding site with FDX1 mRNA in glioma tissues [PMC6684595][PMC10012466]. Hsa-mir-606 is one of the miRNAs identified in a study on differentially expressed miRNAs (DEmiRNAs) in normal brain tissue versus glioma tissues [PMC9629092]. Overall, hsa-mir-606 plays a role in various biological processes by interacting with different target mRNAs.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AAACUACUGAAAAUCAAAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications