Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-5688 precursor URS00007599C8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-5688: Hsa-mir-5688 is a common miRNA that has been identified in several studies [PMC8211532] [PMC8620514] [PMC5928600] [PMC10047351] [PMC8074411] [PMC8109079] [PMC9391105]. It has been found to potentially associate with the SARS-CoV-2 genome, suggesting a role in viral infection [PMC8620514]. Hsa-mir-5688 has also been identified as a potential target site in the sequence of PTK7 3′UTR, indicating its involvement in gene regulation processes [PMC5928600]. Furthermore, it has been included in the list of PRNP-related miRNAs, suggesting its association with prion-related diseases [PMC10047351]. Hsa-mir-5688 is also listed as one of the miRNAs that target SREBF1, which is involved in lipid metabolism and obesity-related diseases such as type 2 diabetes mellitus and obesity-associated type 2 diabetes mellitus [PMC8074411]. Additionally, hsa-mir-5688 has been found to potentially regulate SOX-9 expression by competing with other miRNAs such as hsa-miR-495-3p and hsa-miR-518a-5p, indicating its role in gene expression regulation processes [PMC8109079]. Finally, hsa-mir-5688 is listed as one of the miRNAs that target IL1β and PTGS2, which are involved in inflammatory processes and immune response regulation. These findings suggest that hsa-mir-5688 may play a role in various biological processes and disease pathways.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAAACACUUUGCCUUUUUACAGGAGUUUAUUAUGUUUUGGACAUAGAAACAUAACAAACACCUGUAAAACAGCAAAGUGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications