Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Homo sapiens. Annotated by 6 databases (GeneCards, miRBase, RefSeq, Ensembl, HGNC, ENA). Homo sapiens (human) microRNA hsa-mir-6507 precursor sequence is a product of mir-6507 precurso, ENSG00000274056.1, mir-6507 precursor, hsa-mir-6507 precursor, mir-6507, MIR6507 genes. Found in the human reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
GGAGGGAAGAAUAGGAGGGACUUUGUAUUGUGGUUCAGUACCAUGCAAAGUCCUUCCUAUUUUUCCCUCC
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.