Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) hsa-miR-1911-5p URS00007455B8_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1911: Hsa-mir-1911 is a differentially expressed microRNA (miRNA) in breast cancer patients [PMC7236498]. Further research is needed to investigate the association between UNC5C and hsa-mir-1911, as well as hsa-mir-3934 and hsa-mir-526b, in breast cancer patients [PMC7236498]. A prognostic gene signature, including hsa-mir-1911, was developed and a MiR Score prognostic model was constructed using these miRNAs [PMC7236498]. UNC5C was identified as a potential target for hsa-mir-1911, hsa-mir-3934, and hsa-mir-526b through Targetscan [PMC7236498]. Survival analysis revealed that hsa-mir-1911 is one of the 13 miRNAs with prognostic capability in breast cancer patients [PMC10105697]. Additionally, survival analysis confirmed the prognostic capability of other miRNAs such as hsa-miR-21, hsa-miR-146b, and hsa-miR-185 [PMC10105697].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGAGUACCGCCAUGUCUGUUGGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Bos taurus bta-miR-1911
  2. Canis lupus familiaris (dog) Cfa-Mir-1911_5p (mature (guide))
  3. Cervus elaphus Cel-miR-1911-5p
  4. Macaca mulatta (Rhesus monkey) Mml-Mir-1911_5p (mature (guide))
  5. Pteropus alecto pal-miR-1911-5p
Publications