Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-505 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-505 precursor URS000072D134_9606

  • 84 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, MalaCards, miRBase, RefSeq, Rfam)
  • Found in 24 species

Automated summary: This pre miRNA sequence is 84 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (HGNC, RefSeq, GeneCards, Ensembl/GENCODE, MalaCards, miRBase, Rfam, ENA, Ensembl). Described in 33 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-505, RF00781). Homo sapiens (human) microRNA hsa-mir-505 precursor sequence is a product of MIR505, mir-505 precurso, 505, hsa-mir-505 precursor, mir-505, mir-505 precursor genes. Found in the human reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAUGCACCCAGUGGGGGAGCCAGGAAGUAUUGAUGUUUCUGCCAGUUUAGCGUCAACACUUGCUGGUUUCCUCUCUGGAGCAUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 23 other species

    1. Callithrix jacchus microRNA mir-505
    2. Capra hircus (Goat) microRNA mir-505 (MIR505)
    3. Carlito syrichta (Philippine tarsier) miRNA
    4. Cercocebus atys (Sooty mangabey) miRNA
    5. Chlorocebus sabaeus (African green monkey) miRNA
    6. Colobus angolensis palliatus microRNA 505
    7. Dipodomys ordii microRNA mir-505
    8. Equus caballus (horse) microRNA eca-mir-505 precursor
    9. Fukomys damarensis microRNA mir-505
    10. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 505
    11. Heterocephalus glaber microRNA mir-505
    12. Macaca fascicularis (Crab-eating macaque) miRNA
    13. Macaca mulatta microRNA mml-mir-505 precursor
    14. Macaca nemestrina miRNA
    15. Mandrillus leucophaeus (Drill) miRNA
    16. Marmota monax non-coding RNA
    17. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    18. Ovis aries miRNA
    19. Pan paniscus (bonobo) miRNA
    20. Pan troglodytes (chimpanzee) ptr-mir-505
    21. Papio anubis (Olive baboon) miRNA
    22. Rhinopithecus bieti miRNA
    23. Rhinopithecus roxellana microRNA 505
    24. Ictidomys tridecemlineatus microRNA mir-505
    25. Tursiops truncatus (bottlenosed dolphin) microRNA 505 (MIR505)
    2D structure New