Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-520f precursor URS000072A937_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR520F: MIR520F is a miRNA gene that has been studied in various contexts. In glioblastoma patients, the levels of MIR520F, along with other miRNAs such as miR-21, miR-218, and miR-193b, were found to correlate with those detected from tissue biopsies [PMC6679205]. In hepatocellular carcinoma (HCC), the TCGA miRNA-seq dataset was used to analyze the cumulative expression of all 46 C19MC miRNA genes, including MIR520F [PMC7378193]. Furthermore, in glioblastoma patients, a panel of nine miRNAs including MIR520F was found to correlate with tissue biopsies and showed associations with tumor volume [PMC7014190] [PMC9965735]. Additionally, MIR520F was listed as part of a group of microRNAs detected in cerebrospinal fluid (CSF) samples [PMC8833415]. In breast invasive carcinoma samples, cumulative expression analysis included MIR520F among the 46 C19MC miRNA genes studied [PMC6193703]. Finally, in the context of recurrent pregnancy loss (RPL), MIR520F was found to be downregulated along with other microRNAs such as miR3175 and miR4672 [PMC5572592]. These studies highlight the involvement and potential significance of MIR520F in various diseases and biological processes.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGGCUGUGACCCUCUAAAGGGAAGCGCUUUCUGUGGUCAGAAAGAAAAGCAAGUGCUUCCUUUUAGAGGGUUACCGUUUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Publications