Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-885 precursor URS0000726DE7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR885: MIR885 is a miRNA that has been implicated in various biological processes and diseases. It is a negative regulator of autophagy and has been shown to target genes involved in autophagy, such as ULK1, BECN1, RAB5A, and RB1CC1 [PMC4990999]. In addition, MIR885 has been found to be downregulated in sFRP4 SI cells and upregulated in sFRP4 OE treated cells [PMC6356444]. It has also been shown to be upregulated in CRC cell lines and stimulates migration while downregulating IGFBP-5 [PMC9203274]. MIR885 can suppress ISRE activities induced by IFN-α stimulation [PMC3434395]. Furthermore, MIR885 is involved in the interplay with p73ΔEx2/3 to enhance stemness and self-renewal capacity in less invasive melanoma cells [PMC7765507]. Differential methylation of CG dinucleotides in the promoter regions of MIR885 has also been reported, which might influence its expression [PMC9847511]. Moreover, MIR885 has been implicated as a tumor suppressor miRNA that targets CD276 (B7-H3) and IGFR [PMC4697439] [PMC8506118]. Overall, these findings highlight the diverse roles of MIR885 in various biological processes and its potential as a therapeutic target.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCGCACUCUCUCCAUUACACUACCCUGCCUCUUCUCCAUGAGAGGCAGCGGGGUGUAGUGGAUAGAGCACGGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 24 other species

Publications