Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-601 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-601 precursor URS0000725398_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-601: Hsa-mir-601, identified as one of the altered miRNAs in miRCancer data mining, is a metastamiR [PMC4491873]. In a study on patients with steroid-induced osteonecrosis of the femoral head (SONFH), hsa-mir-601 was found to be upregulated in bone marrow mesenchymal stem cells (BMSCs) [PMC5887684]. The lack of information on hsa-mir-601 prompted its selection for further investigation [PMC8753100]. Furthermore, hsa-mir-601, along with hsa-miR-639, hsa-miR-520c-3p, and hsa-miR-573, exhibited specific expression profiles in a cluster of malignant and normal samples from the transition zone, distinguishing this cluster from other samples [PMC3733730].

MIR601: MIR601, along with MIR4266, MIR1251, and MIR3612, has been found to be associated with spontaneous preterm birth (sPTB) [PMC9884789]. The loading of EXOmiRNA, including miR198 and MIR601, is mediated by hnRNPA2B1 through binding to specific EXO-motifs such as GGAG [PMC8806638]. The oncogene c-Myb has been shown to bind to the promoter of MIR601 [PMC9035158]. To assess the promoter activity of MIR601, a luciferase reporter plasmid containing the MIR601 promoter sequence with a putative binding site of c-Myb was constructed [PMC9035158]. Depletion of c-Myb significantly increased the activity of the MIR601 promoter as observed in a luciferase assay [PMC9035158]. Overexpression of c-Myb repressed both the activity of the MIR601 promoter and the expression of miR-601 [PMC9035158].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAUGAGUUCGUCUUGGUCUAGGAUUGUUGGAGGAGUCAGAAAAACUACCCCAGGGAUCCUGAAGUCCUUUGGGUGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications