v22

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Taeniopygia guttata microRNA mir-153 URS0000722D3F_59729

  • 87 nucleotides
  • 1 database (Rfam)
  • Found in 5 other species
  • pre_miRNA

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
    		•  {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences 
    AGCGGUUGCCAGUGUCAUUUUUGUGAUGUUGCAGCUAGUAAUAUGAGCCCAGUUGCAUAGUCACAAAAGUGAUCAUUGGAAACUGUG

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 5 other species

    1. Acanthisitta chloris microRNA mir-153
    2. Alligator mississippiensis microRNA mir-153
    3. Alligator sinensis microRNA mir-153
    4. Amazona aestiva microRNA mir-153
    5. Anas platyrhynchos microRNA mir-153
    6. Apaloderma vittatum microRNA mir-153
    7. Aptenodytes forsteri microRNA mir-153
    8. Balearica regulorum gibbericeps microRNA mir-153
    9. Buceros rhinoceros silvestris microRNA mir-153
    10. Callipepla squamata microRNA mir-153
    11. Calypte anna microRNA mir-153
    12. Antrostomus carolinensis microRNA mir-153
    13. Cariama cristata microRNA mir-153
    14. Cathartes aura microRNA mir-153
    15. Chaetura pelagica microRNA mir-153
    16. Charadrius vociferus microRNA mir-153
    17. Chelonia mydas microRNA mir-153
    18. Chlamydotis macqueenii microRNA mir-153
    19. Colinus virginianus microRNA mir-153
    20. Colius striatus microRNA mir-153
    21. Columba livia microRNA mir-153
    22. Corvus brachyrhynchos microRNA mir-153
    23. Cuculus canorus microRNA mir-153
    24. Egretta garzetta microRNA mir-153
    25. Eurypyga helias microRNA mir-153
    26. Ficedula albicollis microRNA mir-153
    27. Fulmarus glacialis microRNA mir-153
    28. Gallus gallus (chicken) microRNA gga-mir-153 precursor
    29. Gavia stellata microRNA mir-153
    30. Haliaeetus albicilla microRNA mir-153
    31. Latimeria chalumnae (coelacanth) microRNA 153-2 (ENSLACG00000021612.1)
    32. Lepisosteus oculatus microRNA 153-2 (ENSLOCG00000018806.1)
    33. Leptosomus discolor microRNA mir-153
    34. Lonchura striata domestica microRNA mir-153
    35. Manacus vitellinus microRNA mir-153
    36. Meleagris gallopavo microRNA mir-153
    37. Merops nubicus microRNA mir-153
    38. Mesitornis unicolor microRNA mir-153
    39. Nestor notabilis microRNA mir-153
    40. Nipponia nippon microRNA mir-153
    41. Opisthocomus hoazin microRNA mir-153
    42. Patagioenas fasciata monilis microRNA mir-153
    43. Pelecanus crispus microRNA mir-153
    44. Pelodiscus sinensis (Chinese softshell turtle) microRNA 153-2 (ENSPSIG00000019811.1)
    45. Phaethon lepturus microRNA mir-153
    46. Phalacrocorax carbo microRNA mir-153
    47. Phoenicopterus ruber ruber microRNA mir-153
    48. Dryobates pubescens microRNA mir-153
    49. Podiceps cristatus microRNA mir-153
    50. Pterocles gutturalis microRNA mir-153
    51. Pygoscelis adeliae microRNA mir-153
    52. Salmo salar microRNA mir-153
    53. Struthio camelus australis microRNA mir-153
    54. Tauraco erythrolophus microRNA mir-153
    55. Tinamus guttatus microRNA mir-153
    56. Tyto alba microRNA mir-153