Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Meleagris gallopavo microRNA mir-455 URS0000721F74_9103

  • 86 nucleotides
  • 1 database (Rfam)
  • Found in 2 other species
  • pre_miRNA

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    UCCCUGGUGUGAGGGUAUGUGCCCUUGGACUACAUCGUGGAAGCCAGCACCAUGCAGUCCAUGGGCAUAUACACUUGCCUCAAGGU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 2 other species

    1. Acanthisitta chloris microRNA mir-455
    2. Alligator mississippiensis microRNA mir-455
    3. Anas platyrhynchos microRNA mir-455
    4. Apaloderma vittatum microRNA mir-455
    5. Aptenodytes forsteri microRNA mir-455
    6. Balearica regulorum gibbericeps microRNA mir-455
    7. Buceros rhinoceros silvestris microRNA mir-455
    8. Callipepla squamata microRNA mir-455
    9. Calypte anna microRNA mir-455
    10. Antrostomus carolinensis microRNA mir-455
    11. Cariama cristata microRNA mir-455
    12. Cathartes aura microRNA mir-455
    13. Chaetura pelagica microRNA mir-455
    14. Charadrius vociferus microRNA mir-455
    15. Chelonia mydas microRNA mir-455
    16. Chlamydotis macqueenii microRNA mir-455
    17. Colinus virginianus microRNA mir-455
    18. Colius striatus microRNA mir-455
    19. Corvus brachyrhynchos microRNA mir-455
    20. Cuculus canorus microRNA mir-455
    21. Egretta garzetta microRNA mir-455
    22. Eurypyga helias microRNA mir-455
    23. Ficedula albicollis microRNA mir-455
    24. Fulmarus glacialis microRNA mir-455
    25. Gallus gallus (chicken) microRNA gga-mir-455 precursor
    26. Gavia stellata microRNA mir-455
    27. Haliaeetus albicilla microRNA mir-455
    28. Leptosomus discolor microRNA mir-455
    29. Lonchura striata domestica microRNA mir-455
    30. Manacus vitellinus microRNA mir-455
    31. Merops nubicus microRNA mir-455
    32. Mesitornis unicolor microRNA mir-455
    33. Nestor notabilis microRNA mir-455
    34. Nipponia nippon microRNA mir-455
    35. Opisthocomus hoazin microRNA mir-455
    36. Patagioenas fasciata monilis microRNA mir-455
    37. Pelecanus crispus microRNA mir-455
    38. Phaethon lepturus microRNA mir-455
    39. Phalacrocorax carbo microRNA mir-455
    40. Phoenicopterus ruber ruber microRNA mir-455
    41. Dryobates pubescens microRNA mir-455
    42. Podiceps cristatus microRNA mir-455
    43. Pterocles gutturalis microRNA mir-455
    44. Pygoscelis adeliae microRNA mir-455
    45. Sarcophilus harrisii microRNA mir-455
    46. Struthio camelus australis microRNA mir-455
    47. Taeniopygia guttata microRNA mir-455
    48. Tauraco erythrolophus microRNA mir-455
    49. Tinamus guttatus microRNA mir-455
    50. Tyto alba microRNA mir-455
    51. Xenopus laevis microRNA mir-455