Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) small nucleolar RNA, H/ACA box 5C (SNORA5C) secondary structure diagram

Homo sapiens (human) small nucleolar RNA, H/ACA box 5C (SNORA5C) URS000072157F_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

SNORA5C: SNORA5C is a type of small nucleolar RNA (snoRNA) that has been investigated in relation to colorectal cancer (CRC) [PMC9110153]. In previous studies, SNORA5C has been found to have a positive effect on proliferation and colony formation in CRC cells [PMC9110153]. It is one of the six ncRNAs that have been identified as central for network topology in CRC [PMC4391585]. The expression of SNORA5C, along with SNORD15B and SNORD48, was measured in human CRC cells and normal colorectal epithelial cells, and it was found that all three snoRNA genes were upregulated in cancerous tissues [PMC9110153]. The upregulation of SNORD15B and SNORA5C suggests that they may have oncogenic functions in the progression of tumorigenesis and metastasis in CRC [PMC9110153]. Additionally, high levels of SNORD15B and SNORA5C were found to be independent prognostic risk factors for overall survival in CRC patients, indicating their potential as prognostic biomarkers for the disease [PMC9110153]. Furthermore, the expression of SNORA5C was significantly associated with clinicopathological parameters related to CRC [PMC9110153]. These findings highlight the potential importance of SNORA5C in CRC development and progression.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGCAGUCAAGUCAAAUUCAGUGCCCGUUUCUGUCAUAGCGGGGGCUGGCCCAGAUGGCUGCCACAGCAAGCUCCACAGCUCAUGGGCCCUGGGUCACCUACCCUGGGACCUGGGGAUAAGUUUGGCUGUGGACAGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

2D structure Publications