Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Colobus angolensis palliatus (Angola colobus) microRNA 342 secondary structure diagram

Colobus angolensis palliatus (Angola colobus) microRNA 342 URS000071B780_336983

Automated summary: This pre miRNA sequence is 99 nucleotides long and is found in Colobus angolensis palliatus. Annotated by 1 database (Ensembl). Described in 1 paper. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-342, RF00760). Found in the angola colobus reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GAAACUGGGCUCAAGGUGAGGGGUGCUAUCUGUGAUUGAGGGACAUGGUUAAUGGAAUUGUCUCACACAGAAAUCGCACCCGUCACCUUGGCCUACUUA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 14 other species

    1. Cercocebus atys (Sooty mangabey) microRNA 342 (MIR342)
    2. Chlorocebus sabaeus (African green monkey) miRNA
    3. Homo sapiens microRNA hsa-mir-342 precursor
    4. Macaca fascicularis miRNA
    5. Macaca mulatta microRNA mml-mir-342 precursor
    6. Macaca nemestrina microRNA 342 (MIR342)
    7. Mandrillus leucophaeus (Drill) microRNA 342 (MIR342)
    8. Nomascus leucogenys (Northern white-cheeked gibbon) miRNA
    9. Papio anubis (Olive baboon) miRNA
    10. Piliocolobus tephrosceles (Ugandan red Colobus) microRNA 342
    11. Pongo abelii microRNA 342
    12. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-342 precursor
    13. Rhinopithecus bieti microRNA 342 (MIR342)
    14. Rhinopithecus roxellana microRNA 342 (MIR342)
    15. Theropithecus gelada microRNA 342
    2D structure New