Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-367 precursor URS0000718CB7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR367: MIR367 is a microRNA that has been studied in various contexts. It has been found that the numbers of daily modRNA transfections required for reprogramming were reduced from 17 [PMC8348611]. In a study, four members of the miR302 cluster (miR302a, miR302b, miR302c, miR302d) were overexpressed, but not MIR367 [PMC4400607]. MIR367 is part of the miR302/367 cluster and is highly expressed in embryonic stem cells but declines rapidly after differentiation [PMC6722449]. It has been found that MIR367 functions as a tumor-promoting microRNA and its inhibition attenuates tumor aggressiveness and proliferation in embryonal tumors [PMC8235499]. MIR367 has also been used in reprogramming processes to induce somatic cells into induced pluripotent stem cells (iPSCs) without introducing exogenous transcription factors [PMC9026204]. In addition, serum MIR367 levels have been found to be aberrantly upregulated in esophageal squamous cell carcinoma (ESCC) patients and may serve as a circulating biomarker for ESCC [PMC6301302]. Furthermore, circulating exosomal miRNAs, including MIR367, have shown potential to discriminate individuals with esophageal adenocarcinoma from healthy controls and nondysplastic Barrett's esophagus [PMC5951134][PMC3466310][PMC8575592][PMC8575592][PMC8575592][PMCID8575592]. Overall, MIR367 plays various roles in different biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CCAUUACUGUUGCUAAUAUGCAACUCUGUUGAAUAUAAAUUGGAAUUGCACUUUAGCAAUGGUGAUGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Publications