Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-626 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-626 precursor URS000071745D_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-626: Hsa-mir-626 is a microRNA that has been found to have differential expression levels in various conditions and diseases. In a study on children with post-concussion syndrome (PPCS), hsa-mir-626 was one of the thirteen microRNAs that showed significant differences in expression levels between children with and without PPCS [PMC9195510]. Additionally, hsa-mir-626 showed a significant interaction between time and history of prior concussion, with expression levels decreasing over time in children with a history of prior concussion but increasing over time in children without a history of prior concussion [PMC9195510]. In another study, hsa-mir-626 was identified as one of the hub microRNAs in the miRNA network associated with poor prognosis, and its target genes were implicated in the cell cycle [PMC8004706]. Hsa-mir-626 has also been implicated in pancreatic cancer, as it was predicted to be a potential target of circRNA_000864 [PMC7793745]. Furthermore, hsa-mir-626 has been found to be dysregulated in Parkinson's disease (PD), being downregulated in serum but upregulated in cerebrospinal fluid (CSF) [PMC9738832]. It has also been suggested as a potential diagnostic biomarker for PD [PMC7982809][PMC9315906]. Hsa-mir-626 has been associated with cancer-related pathways and identified as one of the miRNAs targeted by hsa_circ_0004018 and hsa_circ_0005962 [PMC5601662][PMC5950583][PMC6380039]. Overall, hsa-mir-626 is an important microRNA that plays a role in various biological processes and diseases.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACUGAUAUAUUUGUCUUAUUUGAGAGCUGAGGAGUAUUUUUAUGCAAUCUGAAUGAUCUCAGCUGUCUGAAAAUGUCUUCAAUUUUAAAGGCUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications