Papio anubis (olive baboon) microRNA 1224 (ENSPANG00000000286.3)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio anubis (olive baboon) microRNA 1224 (ENSPANG00000000286.3) URS0000710AB5_9555

85 nucleotides
2 databases (Ensembl, Rfam)
Found in 8 other species
244 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GUGAGGACUCGGGAGGUGGAGGGUGGCGCCGCCGGGGCCAGGCGCUGUCUAAGCUCGCUUCUCCCCCCACCUCCUCUCUCCUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Cercocebus atys (Sooty mangabey) microRNA 1224 (ENSCATG00000024242.1)
Chlorocebus sabaeus microRNA 1224 (ENSCSAG00000024515.1)
Macaca fascicularis microRNA 1224 (ENSMFAG00000012751.2)
Macaca mulatta microRNA mml-mir-1224 precursor
Macaca nemestrina (Pig-tailed macaque) microRNA 1224 (ENSMNEG00000003051.1)
Mandrillus leucophaeus (Drill) microRNA 1224 (ENSMLEG00000014207.1)
Rhinopithecus bieti (Black snub-nosed monkey) microRNA 1224 (ENSRBIG00000009220.1)
Rhinopithecus roxellana microRNA 1224 (ENSRROG00000003410.1)

2D structure

Publications