Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-802 precursor URS000070FC11_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR802: MIR802 is a microRNA that has been found to be overexpressed in various diseases, including cancer, obesity, and diabetes mellitus [PMC8602698]. It has been shown to target MECP2 and CDKN2A, which are involved in glial proliferation [Xia et al., 2009; Basavaraju and De Lencastre, 2016; Mastrototaro and Sessa, 2018]. MIR802 has also been implicated in insulin resistance and glucose uptake in tissues and organs [PMC6625421]. In dairy cows, MIR802 has been identified as a circulating miRNA that may regulate insulin sensitivity and lipid metabolism [PMC9867202]. Additionally, an extra copy of the genes located between MIR802 and Zbtb21 has been shown to increase Aβ aggregation in vivo [PMC8996251]. In the context of Down syndrome (DS), miR-155 (MIRN155) and miR-802 (MIRN802) have been found to be present in triple copy in the Ts65Dn mouse genome [PMC4636806]. MIR802 has also been implicated in cancer progression as a potential tumor suppressor in colorectal cancer [PMC7105370] as well as breast cancer cells proliferation inhibition by downregulating FOXM1 expression [PMC4752991]. Furthermore, MIR802 shows female-biased expression in mouse liver and is elevated in type-II diabetes [PMC7992343]. The genomic region from MIR802 to Zbtb21 on mouse chromosome 16 has also been identified as being sufficient to cause congenital heart defects (CHD) similar to those seen in DS when present in three copies [PMC4764572].\

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUCUGUUAUUUGCAGUCAGUAACAAAGAUUCAUCCUUGUGUCCAUCAUGCAACAAGGAGAAUCUUUGUCACUUAGUGUAAUUAAUAGCUGGAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications