Automated summary: This pre miRNA sequence is 91 nucleotides long and is found in Apis mellifera. Annotated by 5 databases (miRBase, Rfam, Ensembl Metazoa, ENA, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-263, RF00706). Apis mellifera (honey bee) microRNA ame-mir-263b precursor sequence is a product of mir-263b precurso, GeneID_100315679, mir-263b precursor, Mir263b, ame-mir-263b precursor, 263b, mir-263, 263, mir-263b genes. Found in the honey bee reference genome.
This sequence is found in {{ locations.length }} genome
| Go to location | Chromosome | Start | End | Strand | Ensembl | UCSC | Sequence identity | |
|---|---|---|---|---|---|---|---|---|
| Loading genome locations... | ||||||||
| Failed to load data from server | ||||||||
| No genome locations known | ||||||||
|
loading browser
|
{{ location.chromosome }} | {{ location.start | number }} | {{ location.end | number }} | {{ location.strand == "1" ? "forward" : "reverse" }} | {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} | UCSC | 100% | {{ location.identity * 100 | number:0 }}% |
No genome locations found for this sequence. Learn more →
Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset
AAGGUUCUGGCGGGUCUUGGCACUGGAAGAAUUCACAGAUGUGCAGUGUAUAAUCGUGGAUCUUGCAAUGCCAUCACUUGCUGGAUACCGA
View annotations in different species by clicking on species names.
Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.