Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Apis mellifera (honey bee) microRNA ame-mir-263b precursor secondary structure diagram

Apis mellifera (honey bee) microRNA ame-mir-263b precursor URS000070F702_7460

Automated summary: This pre miRNA sequence is 91 nucleotides long and is found in Apis mellifera. Annotated by 5 databases (miRBase, Rfam, Ensembl Metazoa, ENA, RefSeq). Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-263, RF00706). Apis mellifera (honey bee) microRNA ame-mir-263b precursor sequence is a product of mir-263b precurso, GeneID_100315679, mir-263b precursor, Mir263b, ame-mir-263b precursor, 263b, mir-263, 263, mir-263b genes. Found in the honey bee reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    Search for similar sequences
    AAGGUUCUGGCGGGUCUUGGCACUGGAAGAAUUCACAGAUGUGCAGUGUAUAAUCGUGGAUCUUGCAAUGCCAUCACUUGCUGGAUACCGA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 5 other species

    1. Apis florea (little honeybee) microRNA mir-263
    2. Bombus impatiens microRNA mir-263
    3. Bombus terrestris microRNA mir-263
    4. Dufourea novaeangliae microRNA mir-263
    5. Melipona quadrifasciata microRNA mir-263
    2D structure Publications New