Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-581 precursor URS000070DF56_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-581: Hsa-mir-581 is a miRNA that has been identified in various studies and is associated with different types of cancer [PMC3917617]. It has been found to be a risky miRNA in Proneural-G-CIMP and Proneural-non G-CIMP subtype GBM, along with other miRNAs [PMC3917617]. Hsa-mir-581 has also been proposed to have an unexpected role as an inhibitor of proliferation of colon cancer cells [PMC4035288]. In G3, hsa-mir-581 is down-regulated, suggesting a possible relation between this miRNA and cancer [PMC4035288]. Hsa-mir-581 has been identified as a ceRNA that binds to multiple miRNAs, including hsa-miR-1200, hsa-miR-1205, hsa-miR-1248, and others [PMC8351580]. In pancreatic ductal adenocarcinoma (PDAC) tissues, hsa-mir-581 is differentially expressed compared to adjacent normal controls [PMC5649611]. It has also been found to promote the expression of hepatitis B virus surface antigen in hepatocellular carcinoma cells by targeting Dicer and EDEM1 [PMC8213537]. Hsa-mir-581 has been predicted to interact with other miRNAs such as hsa-miR-23b-5p and hsa-miR-93-3p [PMC6115511][PMC4900729][PMC4900729]. Additionally, it is inversely correlated with the neutrophil percentage in bronchoalveolar lavage fluid (BALF) samples [PMC6958500]. Hsa-mir-581 was selected as one of the representative miRNAs for validation using RT-qPCR assays in different studies [PMC5865992][PMC5865992][PMC7595675][PMC8305867][PMC7906134].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GUUAUGUGAAGGUAUUCUUGUGUUCUCUAGAUCAGUGCUUUUAGAAAAUUUGUGUGAUCUAAAGAACACAAAGAAUACCUACACAGAACCACCUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications