Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-563 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-563 precursor URS000070CB5A_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-563: Hsa-mir-563 is a microRNA that has been found to be overexpressed in the progesterone support group and the P + E support group compared to the no steroid supplementation group [PMC3462109]. It is one of the 33 miRNAs that showed overexpression in the progesterone support group [PMC3462109]. Additionally, hsa-mir-563 was also found to be one of the 6 miRNAs that showed overexpression in the P + E support group [PMC3462109]. Hsa-mir-563 was also identified as one of the miRNAs that were differentially expressed in kidney tissue samples of patients with diabetic nephropathy compared to healthy individuals [PMC8616647]. In this study, a total of 67 miRNAs were found to be differentially expressed, with hsa-mir-563 being one of those upregulated [PMC8616647]. Furthermore, hsa-mir-563 was included in a RT primer pool used for relative quantitative real-time PCR analysis along with other miRNAs such as hsa-miR-125a-3p and hsa-miR-375 [PMC4310093]. These primers were used to confirm the results obtained from microarray analysis [PMC4310093].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAAAGAAGUGUGUUGCCCUCUAGGAAAUGUGUGUUGCUCUGAUGUAAUUAGGUUGACAUACGUUUCCCUGGUAGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

2D structure Publications