Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Bos taurus (cattle) microRNA bta-mir-138 precursor (bta-mir-138-2) secondary structure diagram

Bos taurus (cattle) microRNA bta-mir-138 precursor (bta-mir-138-2) URS0000709868_9913

Automated summary: This pre miRNA sequence is 83 nucleotides long and is found in Bos taurus. Annotated by 4 databases (ENA, RefSeq, Rfam, miRBase). Described in 8 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-138, RF00671). Bos taurus (cattle) microRNA bta-mir-138 precursor (bta-mir-138-2) sequence is a product of mir-138, bta-mir-138-2 precursor, mir-138-2 precursor, mir-138-2, 138, mir-138-2 precurso, MIR138-2, 138-2 genes. Found in the cattle reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GUUGCUGCAGCUGGUGUUGUGAAUCAGGCCGACGAGCAGCGCAUCCUCUUACCCGGCUAUUUCACGACACCAGGGUUGCAUCA

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 29 other species

    1. Callithrix jacchus microRNA mir-138
    2. Canis lupus dingo microRNA 138-2
    3. Canis lupus familiaris microRNA 138-2
    4. Capra hircus (Goat) microRNA 138-2
    5. Castor canadensis microRNA 138-2
    6. Chlorocebus sabaeus microRNA mir-138
    7. Choloepus hoffmanni (Hoffmann's two-fingered sloth) microRNA 138-2
    8. Felis catus microRNA mir-138
    9. Gorilla gorilla gorilla microRNA mir-138
    10. Homo sapiens microRNA mir-138
    11. Loxodonta africana microRNA mir-138
    12. Macaca mulatta microRNA mir-138
    13. Microcebus murinus miRNA
    14. Moschus moschiferus microRNA 138-2
    15. Myotis brandtii microRNA mir-138
    16. Myotis davidii microRNA mir-138
    17. Nomascus leucogenys microRNA mir-138
    18. Ochotona princeps miRNA
    19. Oryctolagus cuniculus (rabbit) microRNA 138-2
    20. Otolemur garnettii (small-eared galago) miRNA
    21. Ovis aries microRNA mir-138
    22. Pan troglodytes (chimpanzee) microRNA ptr-mir-138 precursor
    23. Papio anubis microRNA mir-138
    24. Pongo abelii microRNA mir-138
    25. Prolemur simus microRNA 138-2
    26. Propithecus coquereli (Coquerel's sifaka) miRNA
    27. Sciurus vulgaris miRNA
    28. Sus scrofa (pig) miRNA
    29. Vulpes vulpes microRNA 138-2
    30. Zalophus californianus miRNA
    2D structure New