Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1253 precursor URS0000708133_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-1253: Hsa-mir-1253 is a microRNA that has been extensively studied in various contexts. It has been found to have sequence identity to 136 plant viruses/strains, indicating its potential role in viral interactions [PMC3821693]. In addition, hsa-mir-1253 has been shown to affect gene expression in anaerobic species such as Fusobacterium nucleatum and facultative anaerobic species like Escherichia coli [PMC6702754]. It has also been implicated in various diseases and conditions. For example, hsa-mir-1253 has been found to be significantly deregulated in bone mineral density status and HIV-infected breast milk [PMC4577125] [PMC7395778]. Furthermore, hsa-mir-1253 has been associated with ERĪ±36 encoding transcript and its expression levels have been found to be altered in multiple cancers including bladder, lung, and prostate cancer [PMC6600239] [PMC8414803]. Additionally, hsa-mir-1253 has a potential role in tumor suppression through epigenetic silencing in medulloblastoma [PMC8777531]. It is also involved in the regulation of target genes such as PDE7B, DMRT2, and TGFBR3 through interactions with other molecules like circRNAs and miRNAs [PMC7457069]. Overall, hsa-mir-1253 is a versatile microRNA that plays a significant role in various biological processes and disease conditions.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCAGCAAGAGAUAGAAUCCAAAAGAGAAGAAGAUCAGCCUGCAGAUGUGGACUGCUAAAUGCAGGCUGAUCUUCUCCCCUUUGGGAUUCUCUUAUGAGAAGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications