Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (house mouse) microRNA mmu-mir-223 precursor URS00006FEFE5_10090

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

mmu-mir-223: Mmu-mir-223 is a microRNA that is upregulated in various biological contexts [PMC5617494]. In CD34+SCA1+ BMHSCs, the expression of mmu-mir-223 was found to be upregulated after treatment with CTX [PMC5617494]. Knocking out mmu-mir-223 resulted in the de-repression of exclusive targets with 8mer sites, indicating that the 5'-isomiR of mmu-mir-223 affected these targets [PMC3919606]. The expression levels of mmu-mir-223 were normalized against β-actin [PMC4755013]. In UVB irradiated mice, mmu-mir-223 was found to be upregulated compared to untreated mice [PMC3597329]. Mice with DSS-induced colitis were treated with mmu-mir-223 loaded nanoparticles, which resulted in therapeutic effects [PMC9024817]. Mmu-mir-223 mimic treatment repressed the expression of NLRP3 and increased the repression of IL-1β, IL-6, TNF-α, and CXCL1 and CXCL2 mRNA transcripts [PMC6113393]. G1 arrest and the presence of p27 regulated three miRs including mir233 [PMC4012735]. Several miRNAs including mir233 increased their expression significantly at different times post-infection [PMC9861972].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUGGCCAUCUGCAGUGUCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCUGUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGUGGCUCAUGCCUAUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications