Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-583 precursor URS00006FBE08_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

hsa-mir-583: Hsa-mir-583 is a microRNA that has been identified in various studies and is associated with different genes and pathways. It has been found to be dysregulated in different conditions and diseases. For example, in a study on leukocytes isolated from ASL patients, hsa-mir-583 was identified as one of the dysregulated miRNAs [PMC7407981]. Another study found that hsa-mir-583 was differentially expressed between normal colonic mucosa and adenomatous polyp tissue [PMC5023115]. Hsa-mir-583 has also been implicated in the regulation of gene expression. In one study, it was found to be involved in the regulation of XPNPEP1, UCHL1, DBNL, GPC6, and RAD51 expression through sponging other miRNAs [PMC9627163]. Additionally, hsa-mir-583 has been associated with the ALT pathway [PMC5023115]. It has also been identified as a biomarker for obesity-associated type 2 diabetes mellitus [PMC8074411]. Furthermore, hsa-mir-583 has been found to be differentially expressed in LPS-stimulated HaCaT cells irrespective of treatment with adalimumab or CSA [PMC9678002]. In exosomes from donor MCs, hsa-mir-583 was one of the most abundant microRNAs compared to cells [PMC7999363][PMC3760639]. Hsa-mir-583 has also been implicated in circRNA–miRNA interactions [PMC6085698].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AACUCACACAUUAACCAAAGAGGAAGGUCCCAUUACUGCAGGGAUCUUAGCAGUACUGGGACCUACCUCUUUGGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications