Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Gallus gallus (chicken) microRNA gga-mir-32 precursor secondary structure diagram

Gallus gallus (chicken) microRNA gga-mir-32 precursor URS00006F896E_9031

Automated summary: This pre miRNA sequence is 70 nucleotides long and is found in Gallus gallus. Annotated by 4 databases (Rfam, ENA, RefSeq, miRBase). Described in 10 papers. Has a conserved secondary structure or a structured region. Matches 1 Rfam family (mir-32, RF00666). Gallus gallus (chicken) microRNA gga-mir-32 precursor sequence is a product of mir-32 precurso, mir-32 precursor, 32 microRNA precursor family, mir-32 microRNA precursor family, mir-32, 32 microRNA precursor famil, MIR32, gga-mir-32 precursor genes. Found in the chicken reference genome.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAGUGCAAUUUAGUGUGUGCGAUACUUUC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 43 other species

    1. Anas platyrhynchos mir-32 microRNA precursor family
    2. Apaloderma vittatum mir-32 microRNA precursor family
    3. Aptenodytes forsteri mir-32 microRNA precursor family
    4. Buceros rhinoceros silvestris mir-32 microRNA precursor family
    5. Callipepla squamata (scaled quail) mir-32 microRNA precursor family
    6. Calypte anna (Anna's hummingbird) mir-32 microRNA precursor family
    7. Cariama cristata mir-32 microRNA precursor family
    8. Cathartes aura mir-32 microRNA precursor family
    9. Chaetura pelagica mir-32 microRNA precursor family
    10. Charadrius vociferus mir-32 microRNA precursor family
    11. Colinus virginianus mir-32 microRNA precursor family
    12. Colius striatus (speckled mousebird) mir-32 microRNA precursor family
    13. Columba livia mir-32 microRNA precursor family
    14. Cuculus canorus (common cuckoo) mir-32 microRNA precursor family
    15. Egretta garzetta mir-32 microRNA precursor family
    16. Fulmarus glacialis (northern fulmar) mir-32 microRNA precursor family
    17. Gavia stellata mir-32 microRNA precursor family
    18. Haliaeetus albicilla (white-tailed eagle) mir-32 microRNA precursor family
    19. Leptosomus discolor mir-32 microRNA precursor family
    20. Meleagris gallopavo mir-32 microRNA precursor family
    21. Merops nubicus mir-32 microRNA precursor family
    22. Mesitornis unicolor (brown roatelo) mir-32 microRNA precursor family
    23. Nipponia nippon mir-32 microRNA precursor family
    24. Opisthocomus hoazin mir-32 microRNA precursor family
    25. Patagioenas fasciata monilis mir-32 microRNA precursor family
    26. Pelecanus crispus mir-32 microRNA precursor family
    27. Phaethon lepturus mir-32 microRNA precursor family
    28. Phalacrocorax carbo mir-32 microRNA precursor family
    29. Phoenicopterus ruber ruber mir-32 microRNA precursor family
    30. Podiceps cristatus (great crested grebe) mir-32 microRNA precursor family
    31. Pterocles gutturalis (yellow-throated sandgrouse) mir-32 microRNA precursor family
    32. Pygoscelis adeliae (Adelie penguin) mir-32 microRNA precursor family
    33. Struthio camelus australis mir-32 microRNA precursor family
    34. Tauraco erythrolophus (red-crested turaco) mir-32 microRNA precursor family
    35. Tinamus guttatus mir-32 microRNA precursor family
    2D structure Publications New