Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-520c precursor URS00006F562E_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR520C: MIR520C is a type of RNA with no homology to any human genomic sequence [PMC7575175]. In a study, MIR520C, along with other candidate targeted miRNAs (miR128 and miR542), was transfected into U251 cells using Lipofectamine RNAiMAX [PMC7575175]. The expression of MIR520C has been associated with metastatic capabilities such as invasiveness and migration in breast cancer [PMC6771808]. Specifically, MIR520C has been found to inhibit breast cancer epithelial-mesenchymal transition (EMT) by targeting STAT3 [PMC5664073]. In breast invasive carcinoma, the cumulative expression of all 46 C19MC miRNA genes, including MIR520C, was analyzed using gene expression data from the miRNASeq dataset [PMC6193703]. Additionally, the TCGA miRNA-seq dataset of liver hepatocellular carcinoma (HCC) was used to obtain cumulative expression data for all 46 C19MC miRNA genes including MIR520C [PMC7378193]. Other studies have reported that MIR520C is involved in regulating osteoblast differentiation and osteomimicry in bone metastasis [PMC6771808] and that increased levels of MIR520C are associated with primary tumors with osteolytic bone metastasis in breast cancer [PMC6771808]. References: - [PMC7575175]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7575175/ - [PMC6771808]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6771808/ - [PMC5664073]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5664073/ - [PMC6193703]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6193703/ - [PMC7378193]: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7378193/

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCUCAGGCUGUCGUCCUCUAGAGGGAAGCACUUUCUGUUGUCUGAAAGAAAAGAAAGUGCUUCCUUUUAGAGGGUUACCGUUUGAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications