Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 504 (ENSGGOG00000030541.2)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 504 (ENSGGOG00000030541.2) URS00006F1C02_9595

83 nucleotides
1 database (Ensembl)
Found in 8 other species
12 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GCUGCUGUUGGGAGACCCUGGUCUGCACUCUAUCUGUAUUCUUACUGAAGGGAGUGCAGGGCAGGGUUUCCCAUACAGAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

Homo sapiens (human) microRNA hsa-mir-504 precursor
Nomascus leucogenys (Northern white-cheeked gibbon) microRNA 504 (ENSNLEG00000020996.2)
Pan paniscus (bonobo) microRNA 504 (ENSPPAG00000013170.1)
Pan troglodytes (chimpanzee) ptr-mir-504 (ENSPTRG00000027688.2)
Pongo abelii miRNA
Pongo pygmaeus microRNA ppy-mir-504 precursor

Publications