Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-296 precursor URS00006F0310_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR296: MIR296 is an imprinted gene that has been studied in various contexts. It has been found to be hypomethylated in most cases of oral squamous cell carcinoma (OSCC) [PMC5558660]. Additionally, MIR296 has been identified as one of the miRNAs that have complementary sequences to HCV RNA [PMC9780829]. It has also been detected in GM12878 and MCF7 cells, as predicted by read-through transcription units [PMC6824518]. Dysregulation of MIR296 has been observed in the placenta of preeclampsia patients [PMC4464490]. Furthermore, MIR296 is one of the miRNAs found in extracellular vesicles (EVs) derived from periodontal ligament stem cells (PDLSCs) [PMC8745761]. In developmental studies, MIR296 and Mir298 were expressed in mesoderm and endoderm but not ectoderm [PMC8713755]. In stem cells, miR470, along with miR134 and MIR296, plays a role in modulating self-renewal and differentiation by targeting core stemness factors such as Oct4 and Nanog [PMC3772775]. The expression of MIR296 has also been investigated in acute promyelocytic leukemia (APL), with the aim of predicting prognosis [PMC8993542]. Finally, it was found that MIR296 is upregulated 33-fold in cells with a specific genetic variant (MIR204SNP) [PMC4695081].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGGACCCUUCCAGAGGGCCCCCCCUCAAUCCUGUUGUGCCUAAUUCAGAGGGUUGGGUGGAGGCUCUCCUGAAGGGCUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Publications