v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Microcebus murinus (gray mouse lemur) microRNA 361 (ENSMICG00000018182.3) secondary structure diagram

Microcebus murinus (gray mouse lemur) microRNA 361 (ENSMICG00000018182.3) URS00006EF3EB_30608

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAGCUUAUCAGAAUCUCCAGGGGUACUUAUAAUUUGAAAAAGUCCCCCAGGUGUGAUUCUGAUUUGCUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

  1. Bos taurus microRNA bta-mir-361 precursor
  2. Capra hircus microRNA mir-361 (ENSCHIG00000001514.1)
  3. Eptesicus fuscus (big brown bat) microRNA mir-361
  4. Myotis brandtii microRNA mir-361
  5. Myotis davidii microRNA mir-361
  6. Myotis lucifugus microRNA 361 (ENSMLUG00000018027.1)
  7. Ochotona princeps (American pika) miRNA (ENSOPRG00000017529.1)
  8. Ovis aries (sheep) miRNA (ENSOARG00000021372.1)
  9. Sus scrofa microRNA mir-361
 2D structure Publications